View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1849-Insertion-6 (Length: 310)
Name: NF1849-Insertion-6
Description: NF1849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1849-Insertion-6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 4 - 310
Target Start/End: Original strand, 52780149 - 52780455
Alignment:
| Q |
4 |
aacaacggtggcgaatccaacgagtcatttatcggttataggaaatttgattggagcacaagctgcagcagaaatgggttggaaagaaagtgctgtttgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52780149 |
aacaacggtggcgaatccaacgagtcatttatcggttataggaaatttgattggagcacaagctgcagcagaaatgggttggaaagaaagtgctgtttgt |
52780248 |
T |
 |
| Q |
104 |
ttgttttcattagggatggtgcattatttggtgttgtttgtgacactttatcaaaggttgtctggtggtgatcgtcttcctgcgttgttaaggccagttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52780249 |
ttgttttcattagggatggtgcattatttggtgttgtttgtgacactttatcaaaggttgtctggtggtgatcgtcttcctgcgttgttaaggccagttt |
52780348 |
T |
 |
| Q |
204 |
tcttcttgttctttgcagcacctggtgtggctagtttggcttgggaatctattgttggagattttgatactctttccaagatgctattctttttgtccct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52780349 |
tcttcttgttctttgcagcacctggtgtggctagtttggcttgggaatctattgttggagattttgatactctttccaagatgctattctttttgtccct |
52780448 |
T |
 |
| Q |
304 |
attcctc |
310 |
Q |
| |
|
||||||| |
|
|
| T |
52780449 |
attcctc |
52780455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 203 - 309
Target Start/End: Original strand, 17470861 - 17470967
Alignment:
| Q |
203 |
ttcttcttgttctttgcagcacctggtgtggctagtttggcttgggaatctattgttggagattttgatactctttccaagatgctattctttttgtccc |
302 |
Q |
| |
|
||||||||||||||||| || ||| || ||||||||||||||||| ||||| || ||| | ||||||||| ||| |||||||| |||||| | |||| |
|
|
| T |
17470861 |
ttcttcttgttctttgctgctcctagtatggctagtttggcttggcaatctgtttgtggttactttgatactgcttctaagatgctgttctttctctccc |
17470960 |
T |
 |
| Q |
303 |
tattcct |
309 |
Q |
| |
|
| ||||| |
|
|
| T |
17470961 |
tcttcct |
17470967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University