View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1849-Insertion-7 (Length: 144)
Name: NF1849-Insertion-7
Description: NF1849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1849-Insertion-7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 52801787 - 52801644
Alignment:
| Q |
1 |
cccaacaacaaagcaaatcgagtccagacaacccaaccaccacaccaccgccggccagccgccgcgaccactcacatgtcaccttcttctccatccatca |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52801787 |
cccaacaacaaagcaaatcgagtcaagacaacccaaccaccacaccaccgccggccagccgccgcgaccactcacatgtcaccttcttctccatccatca |
52801688 |
T |
|
| Q |
101 |
cccgccaacgcatcctcctgacctcctgcatcttctgtgttatc |
144 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52801687 |
cccgccggcgcatcctcctgacctcctccatcttctgtgttatc |
52801644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 34 - 73
Target Start/End: Complemental strand, 34213098 - 34213059
Alignment:
| Q |
34 |
caaccaccacaccaccgccggccagccgccgcgaccactc |
73 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34213098 |
caaccaccacaccaccgccggtcagccgccgcgaccactc |
34213059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 34 - 73
Target Start/End: Complemental strand, 12003174 - 12003135
Alignment:
| Q |
34 |
caaccaccacaccaccgccggccagccgccgcgaccactc |
73 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12003174 |
caaccaccacaccaccgccggtcagccgccgcgaccactc |
12003135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 34 - 73
Target Start/End: Complemental strand, 21453023 - 21452984
Alignment:
| Q |
34 |
caaccaccacaccaccgccggccagccgccgcgaccactc |
73 |
Q |
| |
|
||||||||||| ||||||||| ||||| |||||||||||| |
|
|
| T |
21453023 |
caaccaccacaacaccgccggtcagccaccgcgaccactc |
21452984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 34 - 73
Target Start/End: Complemental strand, 14654782 - 14654743
Alignment:
| Q |
34 |
caaccaccacaccaccgccggccagccgccgcgaccactc |
73 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14654782 |
caaccaccacaccaccgccggtcagccgccgcgaccactc |
14654743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 34 - 75
Target Start/End: Complemental strand, 33754173 - 33754132
Alignment:
| Q |
34 |
caaccaccacaccaccgccggccagccgccgcgaccactcac |
75 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
33754173 |
caaccaccacaccaccgctggccagctgccacgaccactcac |
33754132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University