View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18491_high_41 (Length: 241)

Name: NF18491_high_41
Description: NF18491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18491_high_41
NF18491_high_41
[»] chr6 (1 HSPs)
chr6 (13-223)||(8166386-8166596)


Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 8166386 - 8166596
Alignment:
13 agcagagagggtcttattgtaaggaatcgggtttaggatggttgagattcaaggaatggaaagtggttgcagtagttgctatcattcttggatttgttct 112  Q
    ||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||||||| | |||||||||||| |||||||| ||||    
8166386 agcagagagggtcttattgtaaggaatcgggtttaggatggatgaaattgaaggaatggaaagtggttgcaatcgttgctatcattgttggatttcttct 8166485  T
113 tgcggttttggtgtttggagttttgttatgtaaaaaatgtcgtttgacgaagaaaactagaaaggatgtgttgctgaaaattgttcaagataaatccaca 212  Q
    |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |    
8166486 tgcggttttggtgtttggagtttttttatgtaaaaaatgtcgtttgatgaagaaaactagaaaggatgtgttgccgaaaattgttcaagataaatccaaa 8166585  T
213 accggtgtttc 223  Q
    || ||||||||    
8166586 actggtgtttc 8166596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University