View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18491_high_43 (Length: 240)
Name: NF18491_high_43
Description: NF18491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18491_high_43 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 12279523 - 12279303
Alignment:
| Q |
18 |
atattaggtatattgaggtatcttgtttcttttagttaaaacatatggacaagtacaaagaatttcgtgtggcattatgaaacattgcaaagttcatgtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12279523 |
atattaggtatattgaggtatcttgtttcttttagttaaaacatatggacaagtacaaagaatttcgtgtgccattatgaaacattgcaaagttcatgtg |
12279424 |
T |
|
| Q |
118 |
attctgacttaactgtttaattaatgggtgtgtgttttttggttcatagtataatgtttattgtcataagcaaacagtttaaaatttgatctgtgaaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12279423 |
attctgacttaactgtttaattaatgggt--gtgttttttggttcgtagtataatgtttattgtcataagcaaacagtttaaaatttgatctatgaaaat |
12279326 |
T |
|
| Q |
218 |
tattttaattccaaaaatgttat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12279325 |
tattttaattccaaaaatgttat |
12279303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University