View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18491_high_48 (Length: 230)
Name: NF18491_high_48
Description: NF18491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18491_high_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 32428910 - 32429105
Alignment:
| Q |
1 |
aaggttatagttatttctggacccaccggttccggtaagagccgtctcgcaatggaacttgctaaaatcatcaatggtgaaatcgttagtgccgattctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32428910 |
aaggttatagttatttctggacccaccggttccggtaagagccgtctcgcaatggaacttgctaaaagcatcaatggtgaaatcgttagtgccgattctg |
32429009 |
T |
 |
| Q |
101 |
ttcaggtatcaagttacgataaaaatttcaaacaaaaatcaatactctttannnnnnnngcactatttgaagtgattttcttttgaatgtattatt |
196 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32429010 |
ttcaggtatcaagttacgataaaaaattcaaacaaaaatgaatactctttattttttttgcactatttgaagtgattttcttttgaatgtattatt |
32429105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University