View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18491_high_50 (Length: 224)
Name: NF18491_high_50
Description: NF18491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18491_high_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 7750907 - 7750714
Alignment:
| Q |
13 |
atcaaagggaaagatgtgacgctatctttcactttttattaagcgaggatttgaagataggattgaagcattgatacagaacctagagtttcttgctgat |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750907 |
atcaaagggaaagatgcgacgctatctttcactttttattaagcgaggatttgaagataggattgaagcattgatacagaacctagagtttcttgctgat |
7750808 |
T |
 |
| Q |
113 |
caaaaggatagattggcacttaacaaatttactagtggtgattgtgaaattggagtcttgaaattgttaagagaatttagagctgtatcgaaaa |
206 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750807 |
caaaaggatagattgggacttaacaaatttactagtggtgattgtgaaattggagtcttgaaattgttaagagaatttagagctgtatcgaaaa |
7750714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 15 - 135
Target Start/End: Original strand, 6590575 - 6590695
Alignment:
| Q |
15 |
caaagggaaagatgtgacgctatctttcactttttattaagcgaggatttgaagataggattgaagcattgatacagaacctagagtttcttgctgatca |
114 |
Q |
| |
|
||||||| ||||| |||||| |||||||| ||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6590575 |
caaagggcaagatacgacgctttctttcacgttttattaatcgaggatttgaagctaggattaaagcattgatacagaacctagagtttcttgcagatca |
6590674 |
T |
 |
| Q |
115 |
aaaggatagattggcacttaa |
135 |
Q |
| |
|
|||||||| ||||| |||||| |
|
|
| T |
6590675 |
aaaggataaattgggacttaa |
6590695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 37 - 133
Target Start/End: Complemental strand, 6917904 - 6917808
Alignment:
| Q |
37 |
tctttcactttttattaagcgaggatttgaagataggattgaagcattgatacagaacctagagtttcttgctgatcaaaaggatagattggcactt |
133 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| | |||||||||||||||||||||||| ||||||||||||| || || |||||||||||| |||| |
|
|
| T |
6917904 |
tctttcactttttagtaatcgaggatttgaggctaggattgaagcattgatacagaaggtagagtttcttgcagagaaacaggatagattgggactt |
6917808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University