View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18491_high_51 (Length: 223)
Name: NF18491_high_51
Description: NF18491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18491_high_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 128 - 205
Target Start/End: Complemental strand, 31828140 - 31828063
Alignment:
| Q |
128 |
gatttttatgtgtttactcaaagagatagagacataacagttttgatggtggtggtgatcctctattactcaaagatg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828140 |
gatttttatgtgtttactcaaagagatagagacataacagttttgatggtggtggtgatcctctattactcaaagatg |
31828063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 31828244 - 31828180
Alignment:
| Q |
16 |
agagaatgagatgaaagtacaagtaataaaaacaacccttataatacgggttttttctgttgaat |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828244 |
agagaatgagatgaaagtacaagtaataaaaacaacccttataatacgggttttttctgttgaat |
31828180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University