View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18491_high_53 (Length: 212)
Name: NF18491_high_53
Description: NF18491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18491_high_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 198
Target Start/End: Original strand, 1449982 - 1450163
Alignment:
| Q |
17 |
atatagaagctttatcattcttttattgctgatatatcttccttatttgttcatttgtatatttaggtttcagcaataatttatgttttgataaattcaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1449982 |
atatagaagctttatcattcttttattgctgatatatcttccttatttgttcatttgtatatttaggtttcagcaataatttatgttttcataaattcaa |
1450081 |
T |
 |
| Q |
117 |
gatataaagacaatccaagaaatagttttatgtacaaactgctccgttgtagttttaagccaattgccttagcttttctgtg |
198 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1450082 |
gatataaagacaatccaagcaatagttttatgtacaaactgctccattgtagttttaagccaattgccttagcttttctgtg |
1450163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University