View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18491_low_13 (Length: 439)
Name: NF18491_low_13
Description: NF18491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18491_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 191 - 429
Target Start/End: Complemental strand, 53175081 - 53174843
Alignment:
| Q |
191 |
agaaaatatggttggaaaaggtggttatgctgaggtttacaagggaacattgaaaaatggtgaagaaattgctgtgaagagattaacaagagcttcaaag |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53175081 |
agaaaatatggttggaaaaggtggttatgctgaggtttacaagggaacattgaaaaatggtgaagaaattgctgtgaagagattaacaagagcttcaaag |
53174982 |
T |
|
| Q |
291 |
gatgaaagaaaagagaaagagtttttgacagagattggaacaattggtcatgttcgtcattccaatgttttatctcttctaggatgttgtattgacaatg |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53174981 |
gatgaaagaaaagagaaagagtttttgacagagattggaacaattggtcatgttcgtcattccaatgttttatctcttctaggatgttgtattgacaatg |
53174882 |
T |
|
| Q |
391 |
gactttactttgtttttgaactatccaccacaggttctg |
429 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53174881 |
gactttactttgtttttgaactatccaccactggttctg |
53174843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 53175277 - 53175165
Alignment:
| Q |
1 |
gattcttccatatgaagaagaaacttgtcaaagaccaacttggaaatgtttctcttatgaagagttgtttgatgctaccaatggcttcaactcaggtgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53175277 |
gattcttccatatgaagaagaaacttgtcaaaaaccaacatggaaatgtttctcttatgaagagttgtttgatgctaccaatggcttcaactcaggtgat |
53175178 |
T |
|
| Q |
101 |
taagacttgtttg |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
53175177 |
taagacttgtttg |
53175165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University