View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18491_low_24 (Length: 314)
Name: NF18491_low_24
Description: NF18491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18491_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 6e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 141 - 271
Target Start/End: Original strand, 28479555 - 28479686
Alignment:
| Q |
141 |
aggccacaatatttcaatatggttcagttagcttaattaaggagccttttacgtcaactcacact-aagcaatgaattatgccaaaatgtgtgatagtat |
239 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||| | ||||||| ||||||||||||||||||| |||||| |
|
|
| T |
28479555 |
aggccacaatatttcattatggttcagttagcttaattaaggagccttctaggtcaactcacattgaagcaataaattatgccaaaatgtgtggtagtat |
28479654 |
T |
|
| Q |
240 |
actttcatatgtgccaaatttgacagtgccac |
271 |
Q |
| |
|
||| || |||| ||||||||||||||||||| |
|
|
| T |
28479655 |
actgtcttatgccccaaatttgacagtgccac |
28479686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 55 - 143
Target Start/End: Original strand, 28478918 - 28479007
Alignment:
| Q |
55 |
atggaaaacctgaattgatgttttatcgaaatccaaatgctgacatactttttcgtccagaagaaattg-caagagtctcataaagaagg |
143 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||| | ||||||||||||||| ||| |||||||||||| ||||||||||||||| |||| |
|
|
| T |
28478918 |
atgggaaacctgaattcatgttttatcgaaatcctagtgctgacatacttttccgttcagaagaaattgacaagagtctcataaaaaagg |
28479007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University