View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18491_low_27 (Length: 291)
Name: NF18491_low_27
Description: NF18491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18491_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 273
Target Start/End: Complemental strand, 24315494 - 24315240
Alignment:
| Q |
17 |
aatctatgtaatgttatattatgttatagacgcaaatattatatgtttcatcagcttcttgttgaaaatgctaatgcatctaacaaattatattagatgg |
116 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24315494 |
aatctatgtaatgttatgttatgtta--gacgcaaatattgtatgtttcatcagcttcttgttgaaaatgctaatgcatctaacaaattattttagatgg |
24315397 |
T |
 |
| Q |
117 |
tcatnnnnnnngaactgagactgaaatatctatcatgtgctatcaaccattagcctcgaccttgatcatgttttctcatcagagccatttgcttgttgtt |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24315396 |
tcataaaaaaagaactgagactgaaatatctatcatgtggtatcaaccattagcctcgaccttgatcatgttttctcatcagagccatttgcttgttgtt |
24315297 |
T |
 |
| Q |
217 |
caagtaatggttttgctattttcttgaaatcataattcctaaatgccacttgttttc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24315296 |
caagtaatggttttgctattttcttgaaatcataattcctaaatgccacttcttttc |
24315240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University