View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18491_low_33 (Length: 267)
Name: NF18491_low_33
Description: NF18491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18491_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 42158409 - 42158646
Alignment:
| Q |
18 |
gataacaaagtaaaaaagcacactaaataggatagaagaagttcaaagactttctggcatcggaaacagctttcctatcttccgtaacatacttaagatg |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
42158409 |
gataacaaacgaaaaaagcacactaaataggatagaagaagttcaaagactttctggcatcggaaacagctttcctatcttcggtaacaaccttaagatg |
42158508 |
T |
 |
| Q |
118 |
atatttgaccaatttcctaaaggattgca---------tcaacccagtccctttactctttctcggccatttacgcatgatttcatcattacagccctt- |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42158509 |
atatttgaccaatttcctaaaggattgcatcaacccagtcaacccagtccctttactctttctcggccatttacgcatgatttcatcattacagccctta |
42158608 |
T |
 |
| Q |
208 |
aaactctttctcaagtcccctcagttttttcaaggtgc |
245 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42158609 |
aaactttttctcaagtcccctcagttttttcaaggtgc |
42158646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University