View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18491_low_42 (Length: 241)
Name: NF18491_low_42
Description: NF18491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18491_low_42 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 8166386 - 8166596
Alignment:
| Q |
13 |
agcagagagggtcttattgtaaggaatcgggtttaggatggttgagattcaaggaatggaaagtggttgcagtagttgctatcattcttggatttgttct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||||||| | |||||||||||| |||||||| |||| |
|
|
| T |
8166386 |
agcagagagggtcttattgtaaggaatcgggtttaggatggatgaaattgaaggaatggaaagtggttgcaatcgttgctatcattgttggatttcttct |
8166485 |
T |
 |
| Q |
113 |
tgcggttttggtgtttggagttttgttatgtaaaaaatgtcgtttgacgaagaaaactagaaaggatgtgttgctgaaaattgttcaagataaatccaca |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
8166486 |
tgcggttttggtgtttggagtttttttatgtaaaaaatgtcgtttgatgaagaaaactagaaaggatgtgttgccgaaaattgttcaagataaatccaaa |
8166585 |
T |
 |
| Q |
213 |
accggtgtttc |
223 |
Q |
| |
|
|| |||||||| |
|
|
| T |
8166586 |
actggtgtttc |
8166596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University