View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18491_low_46 (Length: 237)

Name: NF18491_low_46
Description: NF18491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18491_low_46
NF18491_low_46
[»] chr8 (1 HSPs)
chr8 (17-119)||(43745697-43745799)


Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 17 - 119
Target Start/End: Complemental strand, 43745799 - 43745697
Alignment:
17 tttggtacattcttgatcctttgttggatagtattcatgatttcatttggtctgactctaatttctttcgttagatatttggtcggcctttttatcaatt 116  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43745799 tttggtacattcttgatcctttgttggatcgtattcatgatttcatttggtctgactctaatttctttcgttagatatttggtcggcctttttatcaatt 43745700  T
117 tga 119  Q
    |||    
43745699 tga 43745697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University