View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18492_high_26 (Length: 208)
Name: NF18492_high_26
Description: NF18492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18492_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 15 - 163
Target Start/End: Original strand, 43482853 - 43483001
Alignment:
| Q |
15 |
atgaagtacgttatcatatattaaaacatgatatttatttgagattaatttctaatatgacaccaacatcaaatggcaaatcaaatatgtattccgtcga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43482853 |
atgaagtacgttatcatatattaaaacatgatatttatttgagattaatttctaatatgacaccaacatcaaatggcaaatcaaatatgtattccgtcaa |
43482952 |
T |
 |
| Q |
115 |
atcacaccactacacctcactttaatggtacgacatgaaatagttgatt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43482953 |
atcacaccactacacctcactttaatggaacgacatgaaatagttgatt |
43483001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 144
Target Start/End: Complemental strand, 2345427 - 2345385
Alignment:
| Q |
102 |
tgtattccgtcgaatcacaccactacacctcactttaatggta |
144 |
Q |
| |
|
||||||||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
2345427 |
tgtattccgtcaaatcactccactacaccccactttaatggta |
2345385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University