View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18492_low_13 (Length: 362)
Name: NF18492_low_13
Description: NF18492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18492_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 3239296 - 3239348
Alignment:
| Q |
294 |
atcacttgttgacgaccagaggaagagaaagcgtactcgtagatttacagaat |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3239296 |
atcacttgttgacgaccagaggaagagaaagcgtactcgtagatttacagaat |
3239348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 65 - 135
Target Start/End: Original strand, 3243501 - 3243571
Alignment:
| Q |
65 |
atcagaaaccgaacaggagttcaaagaaagtaattattattggagtgtcgacaagttcgtacatttggatg |
135 |
Q |
| |
|
||||||||| ||||||||| |||| | ||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
3243501 |
atcagaaactgaacaggagctcaatgcaagtaattattgctggagtgtcgacaagttcatacatttggatg |
3243571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 289
Target Start/End: Original strand, 3243671 - 3243730
Alignment:
| Q |
227 |
atcaagaagttagcgaggtggatagttcaccagcacaaccaatttttgtcaaggaaatctctt |
289 |
Q |
| |
|
|||||||||||||| || ||||| |||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
3243671 |
atcaagaagttagcaagatggat---tcaccagcgcaaccaatttctgtcaaggaaatctctt |
3243730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University