View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18493_high_10 (Length: 351)
Name: NF18493_high_10
Description: NF18493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18493_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 16 - 340
Target Start/End: Original strand, 43695761 - 43696081
Alignment:
| Q |
16 |
ctcctttcttggtcttgtatatttaggattaggacaacatgtgatgccgccattagtaatgacaacctatcatagtagtaactaaagtatggtttgaatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43695761 |
ctcctttcttggtcttgtatatttaggattaggacaacatgtgatgccgccattagtaatgacaacctatcatagtagtaactaaagtatggtttgaatc |
43695860 |
T |
 |
| Q |
116 |
tagatggttttcacctgatctggttcaatacaagtagaaatattgtagcaaataaatggagctataatttaattttttactttctttccctccacnnnnn |
215 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43695861 |
taggt-gttttcacctgatctggttcaatacaagtagaaa---tttagcaaataaatggagctataatttaattttttactttctttccctccacttttt |
43695956 |
T |
 |
| Q |
216 |
nnncttctctaaaccaaacatggtggtagtgattgcacacaacacaaatccaaataaaagcatatgaatcagtgaaacaccatggcatcactatttattt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43695957 |
tttcttctctaaaccaaacatggtggtagtgattgcacacagcacaaatccaaataaaagcacatgaatcagtgaaacaccatggcatcactatttattt |
43696056 |
T |
 |
| Q |
316 |
ttatcgccgcataagaaaagttcat |
340 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
43696057 |
ttatcgccgcataagaaaagctcat |
43696081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University