View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18493_high_12 (Length: 303)
Name: NF18493_high_12
Description: NF18493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18493_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 11 - 288
Target Start/End: Original strand, 21464061 - 21464338
Alignment:
| Q |
11 |
cacagataaatatataaatggggggtgcagaccatattagtgactattttgaggaaaacaatgcaaaaacacatggggggtatgagctagttttagtgtc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21464061 |
cacaaataaatatataaatggggggtgcagaccatattagtgactattttgaggaaaacaatgcaaaaacacatggggggtatgagctagttttagtgtc |
21464160 |
T |
 |
| Q |
111 |
aaacaaggtatacatgattcaatgttgcagaaaatatatatatgtttatggtaaaagaacagaaccccgaggtagaggaggtggtggtgttggttttcac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21464161 |
aaacaaggtatacatgattcaatgttgcagaaaatatatatatgtttatggtaaaagaacagaaccccgaggtagaggaggtggtggtgttggttttcac |
21464260 |
T |
 |
| Q |
211 |
tccaaaatcttattaaaagaaaaaatgtattgtcttcttttcttgcttctcaacaaagcaagtagttcatgatctcat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21464261 |
tccaaaatcttattaaaagaaaaaatgtattgtcttcttttcttgcttctcaacaaagcaagtagttcatgatctcat |
21464338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University