View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18493_low_19 (Length: 216)

Name: NF18493_low_19
Description: NF18493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18493_low_19
NF18493_low_19
[»] chr7 (2 HSPs)
chr7 (140-193)||(43317081-43317134)
chr7 (16-75)||(43317194-43317253)


Alignment Details
Target: chr7 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 140 - 193
Target Start/End: Complemental strand, 43317134 - 43317081
Alignment:
140 gtactactgtataaagatgcattttctcatgctagtacaagtgatgcttgactt 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43317134 gtactactgtataaagatgcattttctcatgctagtacaagtgatgcttgactt 43317081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 16 - 75
Target Start/End: Complemental strand, 43317253 - 43317194
Alignment:
16 taattctagaaacgaagaatctaaaatatttgaacaaattttcttttgtggataagtctt 75  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||    
43317253 taattctagaaacgaagaatctaaaatctttgaacaaattttcttttgttgataagtctt 43317194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University