View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18493_low_19 (Length: 216)
Name: NF18493_low_19
Description: NF18493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18493_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 140 - 193
Target Start/End: Complemental strand, 43317134 - 43317081
Alignment:
| Q |
140 |
gtactactgtataaagatgcattttctcatgctagtacaagtgatgcttgactt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43317134 |
gtactactgtataaagatgcattttctcatgctagtacaagtgatgcttgactt |
43317081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 16 - 75
Target Start/End: Complemental strand, 43317253 - 43317194
Alignment:
| Q |
16 |
taattctagaaacgaagaatctaaaatatttgaacaaattttcttttgtggataagtctt |
75 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
43317253 |
taattctagaaacgaagaatctaaaatctttgaacaaattttcttttgttgataagtctt |
43317194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University