View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18494_low_15 (Length: 345)
Name: NF18494_low_15
Description: NF18494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18494_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 252 - 331
Target Start/End: Complemental strand, 11163795 - 11163717
Alignment:
| Q |
252 |
tataaatgtaggcttttggccaaaaccctaatcaatgaatgaaaaatttgaattatcttctacttgttctagtcaatttt |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11163795 |
tataaatgtaggcttttggccaaaaccctaatcaatgaat-ttgaatttgaattatcttctacttgttctagtcaatttt |
11163717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 42347186 - 42347117
Alignment:
| Q |
42 |
aactgcaattaactatagctggaggtattgaatgtcattttcaggtgcgtgatagcagtctttaaagtct |
111 |
Q |
| |
|
||||||| ||||||| || || |||||||||| ||||||||||| ||||||||||||| |||| |||||| |
|
|
| T |
42347186 |
aactgcagttaactacagttgaaggtattgaaggtcattttcagatgcgtgatagcagactttgaagtct |
42347117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 63 - 119
Target Start/End: Original strand, 14133846 - 14133902
Alignment:
| Q |
63 |
gaggtattgaatgtcattttcaggtgcgtgatagcagtctttaaagtctaaagagca |
119 |
Q |
| |
|
|||||||| || ||||||||||| || ||||||||| ||||| |||||||||||||| |
|
|
| T |
14133846 |
gaggtattaaaagtcattttcagctgtgtgatagcaatctttgaagtctaaagagca |
14133902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 69 - 119
Target Start/End: Original strand, 45663259 - 45663309
Alignment:
| Q |
69 |
ttgaatgtcattttcaggtgcgtgatagcagtctttaaagtctaaagagca |
119 |
Q |
| |
|
||||| |||||||||| ||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
45663259 |
ttgaaggtcattttcaagtgtgtgatagcaatctttgaagtctaaagagca |
45663309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 61 - 119
Target Start/End: Complemental strand, 50765642 - 50765584
Alignment:
| Q |
61 |
tggaggtattgaatgtcattttcaggtgcgtgatagcagtctttaaagtctaaagagca |
119 |
Q |
| |
|
|||||||||| || ||||||||| ||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
50765642 |
tggaggtattaaaaatcattttcaagtgtgtgatagcaatctttgaagtctaaagagca |
50765584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University