View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18494_low_22 (Length: 284)
Name: NF18494_low_22
Description: NF18494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18494_low_22 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 41375835 - 41375621
Alignment:
| Q |
18 |
gatatgttcttcttctttggcatgaacagattcccaaccaggacgaaaatggatgaaaactgcaatatctatttgacagacgaggacgagaactcgatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41375835 |
gatatgttcttcttctttggcatgaacagattcccaaccaggacgaaaatggattaaaactgcaatatctatttgacagacgaggacgagaactcgatga |
41375736 |
T |
 |
| Q |
118 |
agatgagtgaaaggaagggaaagactagtatctgatttcttgtgttaggggtttaaattnnnnnnnnnnnnnnnctaaatctaaactgttaattaaattc |
217 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
41375735 |
agatgagtgaaaggaaggggaagactaggttctgatttcttgtgttaggggtttaaattaaaaaatgaaaaaaactaaatctaaactgttaattaaatcc |
41375636 |
T |
 |
| Q |
218 |
gacggctcatgttaa |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41375635 |
gacggctcatgttaa |
41375621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 248 - 284
Target Start/End: Original strand, 38790090 - 38790126
Alignment:
| Q |
248 |
ggagaaatttattttaaaggtgaaatagtggggtgtc |
284 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||| |
|
|
| T |
38790090 |
ggagaaattcatcttaaaggtgaaatagtggggtgtc |
38790126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University