View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18494_low_27 (Length: 243)
Name: NF18494_low_27
Description: NF18494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18494_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 31785180 - 31785404
Alignment:
| Q |
1 |
gtgaaacttgttacatgtccagagcaagcttcaagtgtgcaccttccacaaaggatagttttagattgaatacccttcgatgattgttgtcttttctttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31785180 |
gtgaaacttgttacatgtccagagcaagcttcaagtgtgcaccttccaccaaggatagttttagattgaatacccttcggtgattgttgtcttttctttt |
31785279 |
T |
|
| Q |
101 |
tgaatgtgtaatttagctgtagcatatatatagtgaaactatcttagtctttaatccctattattttgttaggtttctttgtctaggtttcagttgtgta |
200 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31785280 |
tgaatgtataatttagctgtagc----atatagtgaaactatcttagtctttaatccctattattttgttgggtttctttgtctaggtttcagttgtgta |
31785375 |
T |
|
| Q |
201 |
taatatgtaattgcagctagtgctttgtg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31785376 |
taatatgtaattgcagctagtgctttgtg |
31785404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University