View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18495_high_13 (Length: 205)
Name: NF18495_high_13
Description: NF18495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18495_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 193
Target Start/End: Original strand, 51423806 - 51423981
Alignment:
| Q |
18 |
ggttgcaccatcctccattctcacttgattgggcaaaattgggaggacaaaggtctgttgccgtcactttaatagaggcttgctctggcttacacccttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51423806 |
ggttgcaccatcctccattctcacttgattgggcaaaattgggaggacaaaggtctgttgccgtcactttaatagaggcttgccctggcttacacccttg |
51423905 |
T |
|
| Q |
118 |
aggagagtccacacatctgatttcataacatgcaccacatgctagacctttgttgaacaaaactgtgctctctgct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51423906 |
aggagagtccacacatctgatttcataacatgcaccacatgctagacctttgttgaacaaaactgtgctcactgct |
51423981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University