View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18495_low_11 (Length: 236)
Name: NF18495_low_11
Description: NF18495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18495_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 16438704 - 16438929
Alignment:
| Q |
1 |
atcggcagagcatgttgaatcttttgttatattgctataatttataattatctgtagattttattgatggattcagatttatagatatttatcatcatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16438704 |
atcggcagagcatgttgaatctttggttaaattgctataatttataattatctgtagattttattgatggattcagatttatagatatttatcatcatcc |
16438803 |
T |
 |
| Q |
101 |
tacacttttttgtatctgc-----aatcatgtttaccagaacgaaggcatatcatcccaatagaacttcgcagttgtgtgtttatatgcgatagcagtac |
195 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16438804 |
tacacttttttgtatctgcaatataatcatgtttaccagaacgaaggtatatcatcccaatagaacttcgcagttgtgtgttcatatgcgatagcagtac |
16438903 |
T |
 |
| Q |
196 |
taggatagttgaccgaatgaaacatc |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
16438904 |
taggatagttgaccgaatgaaacatc |
16438929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University