View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18496_high_12 (Length: 225)
Name: NF18496_high_12
Description: NF18496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18496_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 203
Target Start/End: Original strand, 183769 - 183953
Alignment:
| Q |
19 |
cataggacatgactgtgagattcttaacattatgcttaacacgaaggaaccgaattataacaagtatagttgatcatagttcatattactatgatggaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
183769 |
cataggacatgactgtgagattcttaacattatgcttaacacgaaggaaccgaattataacaagtatagttgatcatagttcatattactatgatggaga |
183868 |
T |
 |
| Q |
119 |
ggtcttcatttttactgtcattggaatttggaagggatgggaaactcccgtttagtctgagcttgaggggtcttcgacagaggag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
183869 |
agtcttcatttttactgtcattggaatttggaagggatgggaaactcccgtttagtctgagcttgaggggtcttcgacagaggag |
183953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 34 - 105
Target Start/End: Original strand, 44607003 - 44607073
Alignment:
| Q |
34 |
tgagattcttaacattatgcttaacacgaaggaaccgaattataacaagtatagttgatcatagttcatatt |
105 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| | || || | |||||||||| |||||||||||||| |
|
|
| T |
44607003 |
tgagattcttaacattatgcttaacaggaaggaaccaagttttagc-agtatagttgttcatagttcatatt |
44607073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 105
Target Start/End: Original strand, 44628487 - 44628539
Alignment:
| Q |
53 |
cttaacacgaaggaaccgaattataacaagtatagttgatcatagttcatatt |
105 |
Q |
| |
|
||||||| ||||||||||| ||||| |||||||||||| |||||| ||||||| |
|
|
| T |
44628487 |
cttaacatgaaggaaccgagttatagcaagtatagttgttcatagctcatatt |
44628539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University