View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18496_low_11 (Length: 240)
Name: NF18496_low_11
Description: NF18496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18496_low_11 |
 |  |
|
| [»] scaffold0650 (1 HSPs) |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0650 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: scaffold0650
Description:
Target: scaffold0650; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 65 - 240
Target Start/End: Original strand, 7316 - 7499
Alignment:
| Q |
65 |
ttcataagtccccttgctgtttaattatgcttattcatgtgtattgcttcctttcgacaaagattgctggtaccccatatatatata--------atcca |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
7316 |
ttcataagtccccttgctgtttaattatgcttattcatgtgtattgcttccttgcgacatagattgctggtaccccatatatatatatatatattttcca |
7415 |
T |
 |
| Q |
157 |
tattactgcatggttttcattgaatttccattgattggaattaaacaaacaccttgccgtgtcaacctattcaaattggtgtgc |
240 |
Q |
| |
|
|||| | ||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
7416 |
tattgccgcatgattttcattgaatttccattgattggaattaaacaaacacctagccgtgtcaacccattcaaattggtgtgc |
7499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 65 - 240
Target Start/End: Original strand, 18432219 - 18432402
Alignment:
| Q |
65 |
ttcataagtccccttgctgtttaattatgcttattcatgtgtattgcttcctttcgacaaagattgctggtaccccatatatatata--------atcca |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
18432219 |
ttcataagtccccttgctgtttaattatgcttattcatgtgtattgcttccttgcgacatagattgctggtaccccatatatatatatatatattttcca |
18432318 |
T |
 |
| Q |
157 |
tattactgcatggttttcattgaatttccattgattggaattaaacaaacaccttgccgtgtcaacctattcaaattggtgtgc |
240 |
Q |
| |
|
|||| | ||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
18432319 |
tattgccgcatgattttcattgaatttccattgattggaattaaacaaacacctagccgtgtcaacccattcaaattggtgtgc |
18432402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University