View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18496_low_16 (Length: 201)
Name: NF18496_low_16
Description: NF18496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18496_low_16 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 31344853 - 31345057
Alignment:
| Q |
1 |
tcgagatgctactttatttttcttttgtactatcttgcattgatgtttctataatttgtgttgcactgcattgtgaagtgtggtagttaactttgatgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31344853 |
tcgagatgctactttatttttcttttgtactatcttgcattgatgtttctataatatgtgttgcactgcattgtgaagtgtggtagttaactttgatgct |
31344952 |
T |
 |
| Q |
101 |
cagtaaggtgaat----aatcactgatgctgtttcatgtttattgtaaacaggttgccacactagcacctaatgtccctgcaatgtatgagctgcatttc |
196 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31344953 |
cagtaaggtgaatgaacaatccctgatgctgtttcatgttgattgtaaacaggttgccacactagcacctaatgtccctgcaatgtatgagctgcatttt |
31345052 |
T |
 |
| Q |
197 |
gcagt |
201 |
Q |
| |
|
||||| |
|
|
| T |
31345053 |
gcagt |
31345057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 116 - 195
Target Start/End: Original strand, 31316277 - 31316356
Alignment:
| Q |
116 |
tcactgatgctgtttcatgtttattgtaaacaggttgccacactagcacctaatgtccctgcaatgtatgagctgcattt |
195 |
Q |
| |
|
||||||||||| || |||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31316277 |
tcactgatgctattgcatgttgttttcaaacaggttgccacactagcaccaaatgtccctgcaatgtatgagctgcattt |
31316356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University