View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18496_low_5 (Length: 465)
Name: NF18496_low_5
Description: NF18496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18496_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 9e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 104 - 304
Target Start/End: Original strand, 5986651 - 5986854
Alignment:
| Q |
104 |
gggtttcgttgctaagcctgaaactaatcctgatggtacaatcaatttgatggcatggcattgctctattcctggaaaggctggggtaatttcatatttc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5986651 |
gggtttcgttgctaagcctgaaactaatcctgatggtacaatcaatttgatggcatggcattgctctattcctggaaaggctggggtaatttcatatttc |
5986750 |
T |
 |
| Q |
204 |
tatacattattatttgcatttaatc---nnnnnnnnnnnnnnnnnntctgtagcaccgacacttctaatcgaaggcaaaggtgtctctgatgtgtttgac |
300 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5986751 |
tatacattattatttgcatttaatcataataataataataataatatctgtagcaccgacacttctaatcgaaggcaaaggtgtctctgatgtgtttgac |
5986850 |
T |
 |
| Q |
301 |
acgt |
304 |
Q |
| |
|
|||| |
|
|
| T |
5986851 |
acgt |
5986854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 247 - 276
Target Start/End: Original strand, 12490574 - 12490603
Alignment:
| Q |
247 |
tctgtagcaccgacacttctaatcgaaggc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12490574 |
tctgtagcaccgacacttctaatcgaaggc |
12490603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University