View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18497_low_5 (Length: 227)
Name: NF18497_low_5
Description: NF18497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18497_low_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 36352805 - 36353014
Alignment:
| Q |
1 |
aaaataacacaattatataactcttagaatgtattccatcacaaaattcaggtggtctttaatattttgctcttatgtcaacataaccattaagtattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36352805 |
aaaataacacaattatataactcttagaatgtattccatcacaaaattcaggtggtctttaatattttgctcttatgtcaacataaccattaagtatt-- |
36352902 |
T |
|
| Q |
101 |
tattcataacaaggtagtttattggaagagaataaagaaaactaattaacctttgtggtaaagtcctaattttagtattgtttgtttagttttatatatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36352903 |
---------------agtttattggaagagaataaagaaaactaattaacctttgtggtaaagtcctagttttagtattgtttgtttagttttatatatt |
36352987 |
T |
|
| Q |
201 |
cttgttgaccatgcaattagatgtttc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
36352988 |
cttgttgaccatgcaattagatgtttc |
36353014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University