View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18498_low_12 (Length: 239)
Name: NF18498_low_12
Description: NF18498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18498_low_12 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 86 - 239
Target Start/End: Complemental strand, 42412649 - 42412496
Alignment:
| Q |
86 |
tgagatagttgagatatcttacaacttaacaagaggtcataattcaataacgttaaaactcttgatagtaatttagtctaaaaatagatgtgttgattaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42412649 |
tgagatagttgagatatcttacaacttaacaagaggtcataattcaataacgttaaaactcttgatagtaatttagtctaaaaatagatgtgttgattaa |
42412550 |
T |
 |
| Q |
186 |
tatgtcattgtatactttcttcgtccaacattattatatttttaatttaagtat |
239 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42412549 |
tgtgtcattgtatactttcttcgtccaacattattatatttttaatttaagtat |
42412496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 50
Target Start/End: Complemental strand, 42412686 - 42412647
Alignment:
| Q |
11 |
atcatcatgtatatttgctttaaaacacgtcatattttga |
50 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42412686 |
atcatcatgtatatttgctttaaaacacttcatattttga |
42412647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University