View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18498_low_12 (Length: 239)

Name: NF18498_low_12
Description: NF18498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18498_low_12
NF18498_low_12
[»] chr4 (2 HSPs)
chr4 (86-239)||(42412496-42412649)
chr4 (11-50)||(42412647-42412686)


Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 86 - 239
Target Start/End: Complemental strand, 42412649 - 42412496
Alignment:
86 tgagatagttgagatatcttacaacttaacaagaggtcataattcaataacgttaaaactcttgatagtaatttagtctaaaaatagatgtgttgattaa 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42412649 tgagatagttgagatatcttacaacttaacaagaggtcataattcaataacgttaaaactcttgatagtaatttagtctaaaaatagatgtgttgattaa 42412550  T
186 tatgtcattgtatactttcttcgtccaacattattatatttttaatttaagtat 239  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||    
42412549 tgtgtcattgtatactttcttcgtccaacattattatatttttaatttaagtat 42412496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 50
Target Start/End: Complemental strand, 42412686 - 42412647
Alignment:
11 atcatcatgtatatttgctttaaaacacgtcatattttga 50  Q
    |||||||||||||||||||||||||||| |||||||||||    
42412686 atcatcatgtatatttgctttaaaacacttcatattttga 42412647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University