View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1849R-Insertion-5 (Length: 293)
Name: NF1849R-Insertion-5
Description: NF1849R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1849R-Insertion-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 9 - 268
Target Start/End: Original strand, 33421432 - 33421691
Alignment:
| Q |
9 |
gattcatcatcccaatgtcccaaaccatcttccaatcactccatttcggcgggattcaccgggccggttactgcaactactcgccgctagtaccggggtc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33421432 |
gattcatcatcccaatgtcccaaaccatcttccaatcactccatttcggcgggattcaccgggccggttactgcaactactcgccgctagtaccggggtc |
33421531 |
T |
|
| Q |
109 |
caacacctccttcagtgaccgtcctcctgctgagatggctccgcttttccctggttgtgattacaatcactggcttattattattgataagcctggtggt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33421532 |
caacacctccttcagtgaccgtcctcctgctgagatggctccgcttttccctggttgtgattacaatcactggcttattattattgataagcctggtggt |
33421631 |
T |
|
| Q |
209 |
gaaggtgctaccaaacagcagatgattgattgttacgtcaaaacccttgcacaggttctg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33421632 |
gaaggtgctaccaaacagcagatgattgattgttacgtcaaaacccttgcacaagttctg |
33421691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 118 - 240
Target Start/End: Complemental strand, 15695423 - 15695301
Alignment:
| Q |
118 |
cttcagtgaccgtcctcctgctgagatggctccgcttttccctggttgtgattacaatcactggcttattattattgataagcctggtggtgaaggtgct |
217 |
Q |
| |
|
|||||| || ||||| ||| | || ||||||||||| || || || |||||||| | || ||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
15695423 |
cttcagcgagcgtccgcctacggatatggctccgctgtttccagggtgtgattatgaacattggcttattgttatggataaacctggtggtgaaggtgct |
15695324 |
T |
|
| Q |
218 |
accaaacagcagatgattgattg |
240 |
Q |
| |
|
| |||||||| ||||||||||| |
|
|
| T |
15695323 |
tcgaaacagcaaatgattgattg |
15695301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 199 - 255
Target Start/End: Complemental strand, 10508345 - 10508289
Alignment:
| Q |
199 |
gcctggtggtgaaggtgctaccaaacagcagatgattgattgttacgtcaaaaccct |
255 |
Q |
| |
|
||||||||||||||||||| | | |||||||||||||||| |||| || ||||||| |
|
|
| T |
10508345 |
gcctggtggtgaaggtgcttctgagcagcagatgattgattattacatccaaaccct |
10508289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University