View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1849_high_5 (Length: 202)
Name: NF1849_high_5
Description: NF1849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1849_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 29553768 - 29553599
Alignment:
| Q |
18 |
tccataagcattgcaattgagatggttagaccatgaaccaaggcatagccagcaaaattcaaatctgcaaggttgagtacatgtcatatgcatgcatcca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29553768 |
tccataagcattgcaattgagatggttagaccatgaaccaaggcatagccagcaaaattcaaacctgcaaggttgagtacatgtcatatgcatgcatcca |
29553669 |
T |
 |
| Q |
118 |
ttgnnnnnnncaattggtctcttgcacttgggacacggcttcgtgtaagcaagtatccaggtcgtgtttt |
187 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29553668 |
ttgtttttttcaattggtctcttgcacttgggacacggcttcgtgtaagcaagtatccaggtcgtatttt |
29553599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 54 - 187
Target Start/End: Complemental strand, 29538872 - 29538739
Alignment:
| Q |
54 |
accaaggcatagccagcaaaattcaaatctgcaaggttgagtacatgtcatatgcatgcatccattgnnnnnnncaattggtctcttgcacttgggacac |
153 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||| | |||| | ||||||||||||||||||| |
|
|
| T |
29538872 |
accaaggcatagccagcaaaattgaaatctgcaaggtgcactacatgtcatatgcatgcatccacggtttttttcaatcgatctcttgcacttgggacac |
29538773 |
T |
 |
| Q |
154 |
ggcttcgtgtaagcaagtatccaggtcgtgtttt |
187 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
29538772 |
ggcttcgtgtaagcaagtatccagttcgtgtttt |
29538739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 46 - 187
Target Start/End: Original strand, 42780980 - 42781121
Alignment:
| Q |
46 |
gaccatgaaccaaggcatagccagcaaaattcaaatctgcaaggttgagtacatgtcatatgcatgcatccattgnnnnnnncaattggtctcttgcact |
145 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||||| || | |||||||||||||||||| |
|
|
| T |
42780980 |
gaccatgcaccaaggcatagccagcaaaattcaaatttgcaaggtggagtacaagtcatatgcatgcaccctaggtttttttcaattggtctcttgcact |
42781079 |
T |
 |
| Q |
146 |
tgggacacggcttcgtgtaagcaagtatccaggtcgtgtttt |
187 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||||| |
|
|
| T |
42781080 |
tgggacacggcttcgagttagcaagtatccagttcgtgtttt |
42781121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 66 - 175
Target Start/End: Complemental strand, 42191354 - 42191245
Alignment:
| Q |
66 |
ccagcaaaattcaaatctgcaaggttgagtacatgtcatatgcatgcatccattgnnnnnnncaattggtctcttgcacttgggacacggcttcgtgtaa |
165 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||| || | | |||| |||||||||||||||||||||||||||| || | |
|
|
| T |
42191354 |
ccagcaaaattcaaatttgcaaggtggagtacatgtcatatgcatgcacccttggtttttttcaatcggtctcttgcacttgggacacggcttcgagtta |
42191255 |
T |
 |
| Q |
166 |
gcaagtatcc |
175 |
Q |
| |
|
|||||||||| |
|
|
| T |
42191254 |
gcaagtatcc |
42191245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University