View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1849_low_6 (Length: 202)

Name: NF1849_low_6
Description: NF1849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1849_low_6
NF1849_low_6
[»] chr3 (2 HSPs)
chr3 (18-187)||(29553599-29553768)
chr3 (54-187)||(29538739-29538872)
[»] chr5 (1 HSPs)
chr5 (46-187)||(42780980-42781121)
[»] chr2 (1 HSPs)
chr2 (66-175)||(42191245-42191354)


Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 29553768 - 29553599
Alignment:
18 tccataagcattgcaattgagatggttagaccatgaaccaaggcatagccagcaaaattcaaatctgcaaggttgagtacatgtcatatgcatgcatcca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
29553768 tccataagcattgcaattgagatggttagaccatgaaccaaggcatagccagcaaaattcaaacctgcaaggttgagtacatgtcatatgcatgcatcca 29553669  T
118 ttgnnnnnnncaattggtctcttgcacttgggacacggcttcgtgtaagcaagtatccaggtcgtgtttt 187  Q
    |||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
29553668 ttgtttttttcaattggtctcttgcacttgggacacggcttcgtgtaagcaagtatccaggtcgtatttt 29553599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 54 - 187
Target Start/End: Complemental strand, 29538872 - 29538739
Alignment:
54 accaaggcatagccagcaaaattcaaatctgcaaggttgagtacatgtcatatgcatgcatccattgnnnnnnncaattggtctcttgcacttgggacac 153  Q
    ||||||||||||||||||||||| |||||||||||||  | |||||||||||||||||||||||  |       |||| | |||||||||||||||||||    
29538872 accaaggcatagccagcaaaattgaaatctgcaaggtgcactacatgtcatatgcatgcatccacggtttttttcaatcgatctcttgcacttgggacac 29538773  T
154 ggcttcgtgtaagcaagtatccaggtcgtgtttt 187  Q
    |||||||||||||||||||||||| |||||||||    
29538772 ggcttcgtgtaagcaagtatccagttcgtgtttt 29538739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 46 - 187
Target Start/End: Original strand, 42780980 - 42781121
Alignment:
46 gaccatgaaccaaggcatagccagcaaaattcaaatctgcaaggttgagtacatgtcatatgcatgcatccattgnnnnnnncaattggtctcttgcact 145  Q
    ||||||| |||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||||| ||   |       ||||||||||||||||||    
42780980 gaccatgcaccaaggcatagccagcaaaattcaaatttgcaaggtggagtacaagtcatatgcatgcaccctaggtttttttcaattggtctcttgcact 42781079  T
146 tgggacacggcttcgtgtaagcaagtatccaggtcgtgtttt 187  Q
    ||||||||||||||| || ||||||||||||| |||||||||    
42781080 tgggacacggcttcgagttagcaagtatccagttcgtgtttt 42781121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 66 - 175
Target Start/End: Complemental strand, 42191354 - 42191245
Alignment:
66 ccagcaaaattcaaatctgcaaggttgagtacatgtcatatgcatgcatccattgnnnnnnncaattggtctcttgcacttgggacacggcttcgtgtaa 165  Q
    |||||||||||||||| |||||||| |||||||||||||||||||||| || | |       |||| |||||||||||||||||||||||||||| || |    
42191354 ccagcaaaattcaaatttgcaaggtggagtacatgtcatatgcatgcacccttggtttttttcaatcggtctcttgcacttgggacacggcttcgagtta 42191255  T
166 gcaagtatcc 175  Q
    ||||||||||    
42191254 gcaagtatcc 42191245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University