View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18500_high_37 (Length: 223)
Name: NF18500_high_37
Description: NF18500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18500_high_37 |
 | |
|
| [»] scaffold0065 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 205
Target Start/End: Complemental strand, 35534580 - 35534389
Alignment:
| Q |
14 |
gcagagagtgtaggaatgaagcaatgcttcaaagagatttgaattggtggtgatgattttgctgaaaatggattgtgcggttttaaagtttcgattttta |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35534580 |
gcagagagtgtaggaatgaagcaatgattcaaagagatttgaattggtggtgatgattttgctgaaaatggattgtgcggttttaaagtttcgattttta |
35534481 |
T |
|
| Q |
114 |
gtgagaatgtgaagaaggaaggaatgggtatgaagggtatgagaattagggttatgggtttggacccaattgaagaatttgagagatagaac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35534480 |
gtgagaatgtgaagaaggaaggaatgggtatgaagggtatgagaattagggttatgggtttggacccaattgaagaatttgagagatagaac |
35534389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 135 - 196
Target Start/End: Complemental strand, 36033 - 35972
Alignment:
| Q |
135 |
gaatgggtatgaagggtatgagaattagggttatgggtttggacccaattgaagaatttgag |
196 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
36033 |
gaatgggtatgaagggtgtgagaattaaagttatgggtttggacccaattgaagaacttgag |
35972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 196
Target Start/End: Original strand, 14206207 - 14206268
Alignment:
| Q |
135 |
gaatgggtatgaagggtatgagaattagggttatgggtttggacccaattgaagaatttgag |
196 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| ||||||||| |||||||||||| ||||| |
|
|
| T |
14206207 |
gaatgggtatgaagggtgtgagaattaaagttacgggtttggatccaattgaagaacttgag |
14206268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 196
Target Start/End: Original strand, 14213955 - 14214016
Alignment:
| Q |
135 |
gaatgggtatgaagggtatgagaattagggttatgggtttggacccaattgaagaatttgag |
196 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| ||||||||| |||||||||||| ||||| |
|
|
| T |
14213955 |
gaatgggtatgaagggtgtgagaattaaagttacgggtttggatccaattgaagaacttgag |
14214016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 196
Target Start/End: Original strand, 52438704 - 52438765
Alignment:
| Q |
135 |
gaatgggtatgaagggtatgagaattagggttatgggtttggacccaattgaagaatttgag |
196 |
Q |
| |
|
|||| |||||||||||| ||||||||| |||||||||||||| |||||||||||| ||||| |
|
|
| T |
52438704 |
gaataggtatgaagggtgtgagaattaaagttatgggtttggatccaattgaagaacttgag |
52438765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University