View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18500_high_38 (Length: 211)
Name: NF18500_high_38
Description: NF18500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18500_high_38 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 37 - 211
Target Start/End: Complemental strand, 43013751 - 43013577
Alignment:
| Q |
37 |
agaaactgttagaataaggttgaggtggtagatagatagatagaaataaactaaggtggctttaaagaaggaataaaacaccagaatttgctctctactt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43013751 |
agaaactgttagaataaggttgaggtggtagatagatagatagatataaactaaggtggctttaaagaaggaataaaacaccagaatttgctctctactt |
43013652 |
T |
 |
| Q |
137 |
taactgactgaaggcaaggcagtgagagaagaaaaataaaggaaaagttgtctgtttgttttctatactcacaca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43013651 |
taactgactgaaggcaaggcagtgagagaagaaaaataaaggaaaagttgtctgtttgttttctatactcacaca |
43013577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University