View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18500_low_18 (Length: 323)
Name: NF18500_low_18
Description: NF18500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18500_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 51294688 - 51294390
Alignment:
| Q |
1 |
aagaactagaccaccatcatatatatataatcaaacgctgatcaagaacaactgcagtaaattattataaaactgactacaaccaaataaagaaaacatt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294688 |
aagaactagaccaccatcatatata----atcaaacgatgatcaagaacaactgcagtaaattattataaaactgactacaaccaaataaagaaaacatt |
51294593 |
T |
 |
| Q |
101 |
atattttacatttggggagggggattattggtaggaaaaacaagaatgaacgaagaagttaaaatgaaatttcaagaagcaatttgttgctcagaatcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294592 |
atattttacatttggggagggggattattggtaggaaaaacaagaatgaa----gaagttaaaatgaaatttcaagaagcaatttgttgctcagaatcag |
51294497 |
T |
 |
| Q |
201 |
tggctcggttggcatagaatctagcaatgaaagcagaagctttcttgtcaataccaggctcagcaacccaacgacctctgtcttcatcacttgcaaatat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294496 |
tggctcggttggcatagaatctagcaatgaaagcagaagctttcttgtcaataccaggctcagcaacccaacgacctctgtcttcatcacttgcaaatat |
51294397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 219 - 306
Target Start/End: Original strand, 19574945 - 19575032
Alignment:
| Q |
219 |
atctagcaatgaaagcagaagctttcttgtcaataccaggctcagcaacccaacgacctctgtcttcatcacttgcaaatatccttct |
306 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||||||||||||||||||||||||| |||||| ||||||||||||||||| || ||||| |
|
|
| T |
19574945 |
atctagcaatgaaatcagaagctttcctatcaataccaggctcagcaacccaacaacctctatcttcatcacttgcaaacattcttct |
19575032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University