View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18500_low_2 (Length: 545)
Name: NF18500_low_2
Description: NF18500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18500_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 195 - 453
Target Start/End: Original strand, 43654881 - 43655135
Alignment:
| Q |
195 |
gagattgtgctgatataagacttgttctattaaaggattttcagcttatatgttgaaatggttatagagcccacttgatttcttttcttgctgaaattgc |
294 |
Q |
| |
|
|||||| |||| ||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43654881 |
gagattatgctcatataagacttgttctatttaaggattttcagcttatatattgaaatggttatagagcccgcttgatttcttttcttgctgaaattgc |
43654980 |
T |
 |
| Q |
295 |
ttaccacttaccagttcatataataccttggtgggtagggatgaaaatatgctaggttagacttttctttttaaatagagaaaatttagacattttaaaa |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43654981 |
ttaccacttaccagttcatataataccttggtgggtagggaagaaaatatgctaggttagacttttctttttaaatagagaaaatttagacattttaaaa |
43655080 |
T |
 |
| Q |
395 |
aatttatatagctaaaaagatcagtcacgagtcatnnnnnnngtcttaacctatcagac |
453 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
43655081 |
aatttatatagctaaaaa----agtcacgagtcataaaaaaagtcttaacctatcagac |
43655135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 43654705 - 43654767
Alignment:
| Q |
18 |
tgtttgctctctttactatatttagcggagaaaacacaaccaaagtgtaaaatgtttgttcgc |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43654705 |
tgtttgctctctttactatatttagcggagaaaacacaaccaaagtgtaaaatgtttgttcgc |
43654767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University