View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18500_low_22 (Length: 315)
Name: NF18500_low_22
Description: NF18500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18500_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 310
Target Start/End: Complemental strand, 7998190 - 7997902
Alignment:
| Q |
19 |
ataataggttgctttaggtgtacaccctgaatttcannnnnnnnnnnnccttgcttccttgattctgtttttaagctcataaatgtatttacttttctta |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7998190 |
ataataggatgctttaggtgtacaccctgaatttcatttttttttt--ccttgcttccttgattctgtttttaagctcataaatgtatttagttttctta |
7998093 |
T |
|
| Q |
119 |
ttttgattttcatccacataaatcatggaggataggggccattggactaattcatgctctatttaaaggctttatttacatccgtctcggaaacaaattt |
218 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7998092 |
ttttgattttcatccacatta-tcatggaggataggggccattggactaattcatgctctatttaaaggctttatttacatccgtctcggaaacaaattt |
7997994 |
T |
|
| Q |
219 |
gtccaatgtttttagaattagattcgttcgagctaatttaattatgatttagaggtcttgccgatacacttttaattttgtcctatgcttct |
310 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
7997993 |
gtccaatgtttttagaattagattcgtttgagccaatttaattatgatttagaggtcttgccgatacacttttaattttgtccaatgtttct |
7997902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 236
Target Start/End: Complemental strand, 7979122 - 7979048
Alignment:
| Q |
162 |
ggactaattcatgctctatttaaaggctttatttacatccgtctcggaaacaaatttgtccaatgtttttagaat |
236 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||| || | |||||||| || ||| |||||||||| |
|
|
| T |
7979122 |
ggactaattcatgttctattagaaggctttatttacatccgtatcaaacacaaatttatcaaatatttttagaat |
7979048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University