View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18500_low_28 (Length: 251)
Name: NF18500_low_28
Description: NF18500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18500_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 37086932 - 37086712
Alignment:
| Q |
16 |
acctaagattagccctgctgctagccatcctccagtttttgttttgtcagccggatgacctcgaaaatcgactgcagcattgtcttctgtgccttttttc |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37086932 |
acctaagattagtcctgctgctagccatcctccggattttgttttgtcagccggatgacctcgaaaatcgaccgcagcattgtcttctgtgccttttttc |
37086833 |
T |
|
| Q |
116 |
tctccattgcttgcaacaagaacctatacnnnnnnnnttaagtcattaacaaagtttcaaggtttgaactttgaacaagtacaaaaattgtacaagatga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37086832 |
tctccattgcttgcaacaagaacctatacaaaaaaaattaagtcattaacaaagtttcaaggtttgaactttgaacaagtacaaaaattgtacaagatga |
37086733 |
T |
|
| Q |
216 |
aatggataccatgttgtatgt |
236 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
37086732 |
aatgaataccatgttgtatgt |
37086712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University