View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18501_high_13 (Length: 211)

Name: NF18501_high_13
Description: NF18501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18501_high_13
NF18501_high_13
[»] chr5 (1 HSPs)
chr5 (24-193)||(8584856-8585025)


Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 24 - 193
Target Start/End: Original strand, 8584856 - 8585025
Alignment:
24 tttgggttttgatttccacattggttccgttcgcgatgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttcaactctcttgc 123  Q
    |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
8584856 tttgtgttttgatttccacattggttccgttcgcaatgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttccactctcttgc 8584955  T
124 ctttgtttcttccaattctttctttgtttgctcaagttctttcttgagggatttgatgcattgtgctaag 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8584956 ctttgtttcttccaattctttctttgtttgctcaagttctttcttgagggatttgatgcattgtgctaag 8585025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University