View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18501_high_13 (Length: 211)
Name: NF18501_high_13
Description: NF18501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18501_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 24 - 193
Target Start/End: Original strand, 8584856 - 8585025
Alignment:
| Q |
24 |
tttgggttttgatttccacattggttccgttcgcgatgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttcaactctcttgc |
123 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8584856 |
tttgtgttttgatttccacattggttccgttcgcaatgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttccactctcttgc |
8584955 |
T |
 |
| Q |
124 |
ctttgtttcttccaattctttctttgtttgctcaagttctttcttgagggatttgatgcattgtgctaag |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8584956 |
ctttgtttcttccaattctttctttgtttgctcaagttctttcttgagggatttgatgcattgtgctaag |
8585025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University