View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18501_low_12 (Length: 219)

Name: NF18501_low_12
Description: NF18501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18501_low_12
NF18501_low_12
[»] chr1 (1 HSPs)
chr1 (17-204)||(8406198-8406385)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 8406198 - 8406385
Alignment:
17 atgaaaaacacgtttggatgatatggaccaagtcaactagcattatgggaaacattgagtcaaccaagtaaacgatcatcatctcatgtgataaggacag 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8406198 atgaaaaacacgtttggatgatatggaccaagtcaactagcattatgggaaacattgagtcaaccaagtaaacgatcatcatctcatgtgataaggacag 8406297  T
117 gtcaatcaagtaaacgttttcacattataaaaattagcaacagaagaaaagcaaggacaagaagccaagcacttaatacgtgaaacct 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8406298 gtcaatcaagtaaacgttttcacattataaaaattagcaacagaagaaaagcaaggacaagaagccaagcacttaatacgtgaaacct 8406385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University