View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18502_low_16 (Length: 248)
Name: NF18502_low_16
Description: NF18502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18502_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 5 - 201
Target Start/End: Original strand, 2350687 - 2350884
Alignment:
| Q |
5 |
attgatccaaattaccattgcaaaaatttacattaatattatatactttcggcaaaataacatatttgatacaaaatgtaatatatagtaaact-nnnnn |
103 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2350687 |
attgatccaaattactattgcaaaaatttacattaatattatatactttcggcaaaataacatatttgatacaaaatgtaacatatagtaaactaaaaaa |
2350786 |
T |
 |
| Q |
104 |
nnnnntatttatacaaaataacatttattctttactatttctaaacaaatgtacttctttaaattagggtgctcgaagtacattttagaggtttttag |
201 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2350787 |
aaaaatattgatacaaaataacatttatactttactatttctaaacaaatgtacttctttaaattagggtgctcgaagtacattttagaggtttttag |
2350884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University