View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18502_low_17 (Length: 241)
Name: NF18502_low_17
Description: NF18502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18502_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 39663270 - 39663402
Alignment:
| Q |
1 |
taagattttgaggggaatgaagcctggtccgaagccttatagttcatacaattaagactgaacttcctttgtgaaactgaaaagcctcgagccagccaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39663270 |
taagattttgaggggaatgaagcctggtccgaagccttatagttcatacaattaagactgaacttcctttgtgaaactgaaaagcctcgagccagccaac |
39663369 |
T |
 |
| Q |
101 |
attcccctcaaataagaagacagacaccttcaa |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39663370 |
attcccctcaaataagaagacagacaccttcaa |
39663402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 157 - 227
Target Start/End: Original strand, 39663424 - 39663494
Alignment:
| Q |
157 |
acccttgatgaaaaccctaaccttcacataccttcttatatatagctagctgagagggaagcacatttatt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39663424 |
acccttgatgaaaaccctaaccttcacataccttcttatatatagctagctgagagggaagcacatttatt |
39663494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University