View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18503_high_23 (Length: 249)
Name: NF18503_high_23
Description: NF18503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18503_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 24440654 - 24440453
Alignment:
| Q |
1 |
tattgggttcatcagagcaaaggaaaactttaagatttagaaaacactttctttttgaaggaggaaataaaa-tacattaatatcaacaaagaattctaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || ||||||| ||||||| |||||||| |
|
|
| T |
24440654 |
tattgggttcatcagagcaaaggaaaactttaagatttagaaaacactttctttttgaaggcggaaataaaaatatattaataccaacaaaaaattctaa |
24440555 |
T |
 |
| Q |
100 |
cttgtacaaggagtgcaaggtaagaattttaaaagtaactacaaacttagagtacaaagtacaaaccaatcaacaacaaaagagaaaaccatcaaaacac |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24440554 |
cttgtacaaggagtgcaaggtaaaaattttaaaagtaactacaaacttagagtacaaagtacaaaccaatcaacaacaaaagagaaaaccatcaaaacac |
24440455 |
T |
 |
| Q |
200 |
tt |
201 |
Q |
| |
|
|| |
|
|
| T |
24440454 |
tt |
24440453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University