View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18503_high_24 (Length: 248)

Name: NF18503_high_24
Description: NF18503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18503_high_24
NF18503_high_24
[»] chr4 (1 HSPs)
chr4 (13-231)||(24060830-24061048)


Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 231
Target Start/End: Complemental strand, 24061048 - 24060830
Alignment:
13 aatatgtgttcctgggtgattgagatgtttttgggttatcataatgatcttgccgaccatgtcgggtcaggagaataaaagcaatgaagagtcccacatg 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
24061048 aatatgtgttcctgggtgattgagatgtttttgggttatcataatgatattgccgaccatgtcgggtcaggagaataaaagcaatgaagagtcccacatg 24060949  T
113 tacacatgtgagctgcatcaggaatggtcacttgatcaggtggtgatggagatttcccgccaataattaattagagattaatcttttaacgtttgaagat 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24060948 tacacatgtgagctgcatcaggaatggtcacttgatcaggtggtgatggagatttcccgccaataattaattagagattaatcttttaacgtttgaagat 24060849  T
213 ccatttatgaagatgatat 231  Q
    |||||||||||||||||||    
24060848 ccatttatgaagatgatat 24060830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University