View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18503_low_15 (Length: 363)
Name: NF18503_low_15
Description: NF18503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18503_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 4e-54; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 131 - 265
Target Start/End: Original strand, 11047065 - 11047202
Alignment:
| Q |
131 |
gttgacgaaagtttttggtcaagaaagtgaatttggattaaactccccttcttgaggaagatatatagtatgttgctgctctggttttcttgagaaatag |
230 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11047065 |
gttgacgaaattttttggtcaagaaagtgaatttggattaaacttcccttcttgaggaagatatatagtatgttgctgctctggttttcttgagaaatag |
11047164 |
T |
|
| Q |
231 |
ttagaatgatctaat---catgtattatgggctataaa |
265 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
11047165 |
ttagaatgatctaatgtagatgcattatgggctataaa |
11047202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 11046914 - 11046959
Alignment:
| Q |
7 |
gagagaaagctgtaaacaaaacaacgaagaatgtttcattctaaaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11046914 |
gagagaaagctgtaaacaaaacaacgaagaatgtttcattctaaaa |
11046959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 297 - 346
Target Start/End: Original strand, 11047194 - 11047243
Alignment:
| Q |
297 |
ggctataaatttgcagatttcacagagaaaaaagaaaatgagtttcccaa |
346 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11047194 |
ggctataaatttgcagatttcacagcgaaaaaagaaaatgagtttcccaa |
11047243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University