View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18503_low_18 (Length: 314)
Name: NF18503_low_18
Description: NF18503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18503_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 4 - 298
Target Start/End: Complemental strand, 8178943 - 8178651
Alignment:
| Q |
4 |
tcatatacctcaaaggatcaaagttttcttatggagggtgcttgggggtgttcttcctacgcgaatgagacttcaagatannnnnnntcccttgttcgga |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8178943 |
tcatatacctcaaaggatcaaagttttcttatggagggtgcttaggggtgttcttcctacgcgaatgagacttcaagataggggg--tcccttgttcgga |
8178846 |
T |
 |
| Q |
104 |
ttgctgcccccattgtgagaccaattatgagaatgattggcacgttttcatcggatgtgtagcagcgaaacaactatggattggagctggactatgggat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||| |
|
|
| T |
8178845 |
ttgctgcccccattgtgagaccaattatgagaatgattggcacgttttcatcggatgtgtagcagcgaaacaagtatggattgaagctgggctatgggat |
8178746 |
T |
 |
| Q |
204 |
gtaatagcagcaggtatcgatgctgccacgggactagctgcacatttatttactgttttttgcaggctgcaaaatcatttgtgtagggacatagc |
298 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8178745 |
gtaatagcagcaggtatcgatgccgccacgggactggctgcacatttatttactgttttttgcaggctgcaaaatcatttgtgcagggacatagc |
8178651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 91 - 298
Target Start/End: Complemental strand, 37604470 - 37604263
Alignment:
| Q |
91 |
tcccttgttcggattgctgcccccattgtgagaccaattatgagaatgattggcacgttttcatcggatgtgtagcagcgaaacaactatggattggagc |
190 |
Q |
| |
|
|||||| |||||| | ||||||| |||||||||||||||||||||||||||||| |||| |||||||||| || | |||||| | ||||||| ||| |
|
|
| T |
37604470 |
tcccttcttcggactactgccccttctgtgagaccaattatgagaatgattggcacatttttatcggatgtgaagtggggaaacaggtttggattgaagc |
37604371 |
T |
 |
| Q |
191 |
tggactatgggatgtaatagcagcaggtatcgatgctgccacgggactagctgcacatttatttactgttttttgcaggctgcaaaatcatttgtgtagg |
290 |
Q |
| |
|
| | |||||||| ||| |||||||||||| | |||||| ||||| || |||||||| ||| || |||| |||||||||| |||| | || || ||| |
|
|
| T |
37604370 |
taggttatgggatacgataacagcaggtatcggtagtgccacaggactggcagcacatttgttttctattttctgcaggctgccaaatgaattatgcagg |
37604271 |
T |
 |
| Q |
291 |
gacatagc |
298 |
Q |
| |
|
|||||||| |
|
|
| T |
37604270 |
gacatagc |
37604263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 162
Target Start/End: Original strand, 49915113 - 49915161
Alignment:
| Q |
114 |
cattgtgagaccaattatgagaatgattggcacgttttcatcggatgtg |
162 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || || || ||||||| |
|
|
| T |
49915113 |
cattgtgagacaaattatgagaatgattggcatgtgtttataggatgtg |
49915161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University