View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18503_low_23 (Length: 294)
Name: NF18503_low_23
Description: NF18503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18503_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 142 - 281
Target Start/End: Original strand, 33265760 - 33265899
Alignment:
| Q |
142 |
tttcaaattgaaggaaagcagtatattcccaagcatcattgattgctgctcaaggaatattttctgatatataaacttttgctaccctcaaaatgactag |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33265760 |
tttcaaattgaaggaaagcagtatattcccaagcatcattgattgctgctcaaggaatattttctgatatataaacttttactaccctcaaaatgactag |
33265859 |
T |
 |
| Q |
242 |
gaacattaggatttcatactgtattatagcctctctgatg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33265860 |
gaacattaggatttcatactgtattataacctctctgatg |
33265899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 20 - 118
Target Start/End: Original strand, 33265666 - 33265764
Alignment:
| Q |
20 |
tgagtcccctccaaagataaatttgttatgagattatggggcaataccttaatcaccagtttgaagaattagcccctctcaaaaatgtgtatattttca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33265666 |
tgagtcccctccaaagataaatttgttatgagattatggggcaatatcttaatcaccagtttgaagaattagcccctctcaaaaatgtgtatattttca |
33265764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University