View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18503_low_27 (Length: 264)
Name: NF18503_low_27
Description: NF18503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18503_low_27 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 264
Target Start/End: Complemental strand, 35440768 - 35440521
Alignment:
| Q |
17 |
ccttttcactttcatcattgtgtttttcatagatagcttgtcttttgccttctgaatgagctacttgttccactacaaaatgaagcaaactagttttacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35440768 |
ccttttcactttcatcattgtgtttttcatagatagcttgtcttttgccttctgaatgagctacttgttccactacaaaatgaagcaaactagttttacc |
35440669 |
T |
|
| Q |
117 |
atttgtgctttttacaccggaaagttttgttagagcactcaggttgaaaccttgcgcattgcctcttgaagttccagcattcattctgttaccagttttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35440668 |
atttgtgctttttacaccggaaagttttgtaagagcactcaggttgaaaccttgcgcattgcctcttgaagttccagcattcattctgttaccagttttg |
35440569 |
T |
|
| Q |
217 |
agaattgcctcaaggagtttcaaaaatggaccactagttttcagttcc |
264 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35440568 |
agaattgcctcaaggagtttcaaaaatagaccactagttttcagttcc |
35440521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University