View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18503_low_32 (Length: 248)
Name: NF18503_low_32
Description: NF18503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18503_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 231
Target Start/End: Complemental strand, 24061048 - 24060830
Alignment:
| Q |
13 |
aatatgtgttcctgggtgattgagatgtttttgggttatcataatgatcttgccgaccatgtcgggtcaggagaataaaagcaatgaagagtcccacatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24061048 |
aatatgtgttcctgggtgattgagatgtttttgggttatcataatgatattgccgaccatgtcgggtcaggagaataaaagcaatgaagagtcccacatg |
24060949 |
T |
 |
| Q |
113 |
tacacatgtgagctgcatcaggaatggtcacttgatcaggtggtgatggagatttcccgccaataattaattagagattaatcttttaacgtttgaagat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24060948 |
tacacatgtgagctgcatcaggaatggtcacttgatcaggtggtgatggagatttcccgccaataattaattagagattaatcttttaacgtttgaagat |
24060849 |
T |
 |
| Q |
213 |
ccatttatgaagatgatat |
231 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24060848 |
ccatttatgaagatgatat |
24060830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University